positive controls Search Results


96
Zymo Research pcr positive control
Pcr Positive Control, supplied by Zymo Research, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr positive control/product/Zymo Research
Average 96 stars, based on 1 article reviews
pcr positive control - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

96
Zymo Research human methylated control dna
Human Methylated Control Dna, supplied by Zymo Research, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human methylated control dna/product/Zymo Research
Average 96 stars, based on 1 article reviews
human methylated control dna - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

98
Multi Sciences (Lianke) Biotech Co Ltd apoptosis
Apoptosis, supplied by Multi Sciences (Lianke) Biotech Co Ltd, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/apoptosis/product/Multi Sciences (Lianke) Biotech Co Ltd
Average 98 stars, based on 1 article reviews
apoptosis - by Bioz Stars, 2026-03
98/100 stars
  Buy from Supplier

97
New England Biolabs nucleocapsid n gene
Nucleocapsid N Gene, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nucleocapsid n gene/product/New England Biolabs
Average 97 stars, based on 1 article reviews
nucleocapsid n gene - by Bioz Stars, 2026-03
97/100 stars
  Buy from Supplier

94
ZeptoMetrix corporation zeptometrix inactivated virus controls
Zeptometrix Inactivated Virus Controls, supplied by ZeptoMetrix corporation, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/zeptometrix inactivated virus controls/product/ZeptoMetrix corporation
Average 94 stars, based on 1 article reviews
zeptometrix inactivated virus controls - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

96
Genecopoeia gluc on promoter reporter
Gluc On Promoter Reporter, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gluc on promoter reporter/product/Genecopoeia
Average 96 stars, based on 1 article reviews
gluc on promoter reporter - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

95
Integrated DNA Technologies mouse rna standards
Mouse Rna Standards, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse rna standards/product/Integrated DNA Technologies
Average 95 stars, based on 1 article reviews
mouse rna standards - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

97
New England Biolabs sars cov 2
Sars Cov 2, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sars cov 2/product/New England Biolabs
Average 97 stars, based on 1 article reviews
sars cov 2 - by Bioz Stars, 2026-03
97/100 stars
  Buy from Supplier

90
Alomone Labs pro bdnf
Pro Bdnf, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pro bdnf/product/Alomone Labs
Average 90 stars, based on 1 article reviews
pro bdnf - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Alomone Labs bdnf stimulation
Rab11 activity is required for a distinctive CREB-mediated gene expression pattern in response to <t>BDNF.</t> A, To explore BDNF-induced changes in the expression of multiple CREB-regulated genes, we used a PCR array including 84 genes with cAMP, calcium, and serum response elements. Reliable data obtained from 76 of the genes in six independent experiments were categorized by their annotated functions and plotted as a fold change in BDNF-stimulated neurons compared with nonstimulated neurons in both groups expressing EGFP, resulting in significant differences in 11 of these genes. B, To study the effect of BDNF on neurons expressing Rab11DN, we studied the fold change in BDNF-stimulated to nonstimulated neurons, with both groups expressing Rab11 DN. In this case, only two genes (Egr1 and Egr2) were upregulated by BDNF, and overall, the expression of Rab11DN downregulated the BDNF response. C, To corroborate that Rab11DN expression downregulates the BDNF response, neurons expressing EGFP (control) or Rab11DN and treated with BDNF were compared. The analysis indicated an overall attenuation of the BDNF effect: 3 of the 11 genes upregulated by BDNF in A were downregulated in a statistically significant manner. D, Changes in the expression of the early-response gene Arc following 4 h of <t>BDNF</t> <t>stimulation</t> were studied in neurons expressing control EGFP or DN mutant Rab11. Arc is not included in the commercial PCR array and was used as a positive control of BDNF response. Statistical significance of gene expression data was analyzed by using a paired Student's t test. The level of significance for the different tests is indicated as follows: *p < 0.05; **p < 0.01. A summary of the statistics for this figure, including tests, degrees of freedom, and exact p values, has been included in Extended Data Figure 6-1 supporting Figure 6. See Extended Data Figure 6-2 for a complete list of reliable genes. Extended Data Figure 6-3 includes the raw data and analysis step by step of the PCR array of the six replicas performed.
Bdnf Stimulation, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bdnf stimulation/product/Alomone Labs
Average 90 stars, based on 1 article reviews
bdnf stimulation - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

97
AMS Biotechnology heparanase assay
Fig. 3. Detection of HPSE activity. <t>Heparanase</t> activity in protein extracts (A) and serum- free conditioned medium (B) obtained from HPSE-silenced-HK2, HK2 wt and HEK293 cell lines. Cells were treated with 60 μg/ml of BSA or AGE (hatched bars) in serum free medium (black bars). Enzymatic activity is expressed as nanograms of heparan sulfate (HS) removed per minute. The results represent the mean±standard deviation of two separate experiments performed in triplicate. Platelet extract was used as a positive control (white bar) (*pb0.05, **pb0.001 vs. HK2 wt control; #pb0.05, ##pb0.001 vs. HEK293 control).
Heparanase Assay, supplied by AMS Biotechnology, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/heparanase assay/product/AMS Biotechnology
Average 97 stars, based on 1 article reviews
heparanase assay - by Bioz Stars, 2026-03
97/100 stars
  Buy from Supplier

90
OriGene cacaagctggagtacaactacaacagcca
Fig. 3. Detection of HPSE activity. <t>Heparanase</t> activity in protein extracts (A) and serum- free conditioned medium (B) obtained from HPSE-silenced-HK2, HK2 wt and HEK293 cell lines. Cells were treated with 60 μg/ml of BSA or AGE (hatched bars) in serum free medium (black bars). Enzymatic activity is expressed as nanograms of heparan sulfate (HS) removed per minute. The results represent the mean±standard deviation of two separate experiments performed in triplicate. Platelet extract was used as a positive control (white bar) (*pb0.05, **pb0.001 vs. HK2 wt control; #pb0.05, ##pb0.001 vs. HEK293 control).
Cacaagctggagtacaactacaacagcca, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cacaagctggagtacaactacaacagcca/product/OriGene
Average 90 stars, based on 1 article reviews
cacaagctggagtacaactacaacagcca - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


Rab11 activity is required for a distinctive CREB-mediated gene expression pattern in response to BDNF. A, To explore BDNF-induced changes in the expression of multiple CREB-regulated genes, we used a PCR array including 84 genes with cAMP, calcium, and serum response elements. Reliable data obtained from 76 of the genes in six independent experiments were categorized by their annotated functions and plotted as a fold change in BDNF-stimulated neurons compared with nonstimulated neurons in both groups expressing EGFP, resulting in significant differences in 11 of these genes. B, To study the effect of BDNF on neurons expressing Rab11DN, we studied the fold change in BDNF-stimulated to nonstimulated neurons, with both groups expressing Rab11 DN. In this case, only two genes (Egr1 and Egr2) were upregulated by BDNF, and overall, the expression of Rab11DN downregulated the BDNF response. C, To corroborate that Rab11DN expression downregulates the BDNF response, neurons expressing EGFP (control) or Rab11DN and treated with BDNF were compared. The analysis indicated an overall attenuation of the BDNF effect: 3 of the 11 genes upregulated by BDNF in A were downregulated in a statistically significant manner. D, Changes in the expression of the early-response gene Arc following 4 h of BDNF stimulation were studied in neurons expressing control EGFP or DN mutant Rab11. Arc is not included in the commercial PCR array and was used as a positive control of BDNF response. Statistical significance of gene expression data was analyzed by using a paired Student's t test. The level of significance for the different tests is indicated as follows: *p < 0.05; **p < 0.01. A summary of the statistics for this figure, including tests, degrees of freedom, and exact p values, has been included in Extended Data Figure 6-1 supporting Figure 6. See Extended Data Figure 6-2 for a complete list of reliable genes. Extended Data Figure 6-3 includes the raw data and analysis step by step of the PCR array of the six replicas performed.

Journal: The Journal of Neuroscience

Article Title: The Rab5–Rab11 Endosomal Pathway is Required for BDNF-Induced CREB Transcriptional Regulation in Hippocampal Neurons

doi: 10.1523/JNEUROSCI.2063-19.2020

Figure Lengend Snippet: Rab11 activity is required for a distinctive CREB-mediated gene expression pattern in response to BDNF. A, To explore BDNF-induced changes in the expression of multiple CREB-regulated genes, we used a PCR array including 84 genes with cAMP, calcium, and serum response elements. Reliable data obtained from 76 of the genes in six independent experiments were categorized by their annotated functions and plotted as a fold change in BDNF-stimulated neurons compared with nonstimulated neurons in both groups expressing EGFP, resulting in significant differences in 11 of these genes. B, To study the effect of BDNF on neurons expressing Rab11DN, we studied the fold change in BDNF-stimulated to nonstimulated neurons, with both groups expressing Rab11 DN. In this case, only two genes (Egr1 and Egr2) were upregulated by BDNF, and overall, the expression of Rab11DN downregulated the BDNF response. C, To corroborate that Rab11DN expression downregulates the BDNF response, neurons expressing EGFP (control) or Rab11DN and treated with BDNF were compared. The analysis indicated an overall attenuation of the BDNF effect: 3 of the 11 genes upregulated by BDNF in A were downregulated in a statistically significant manner. D, Changes in the expression of the early-response gene Arc following 4 h of BDNF stimulation were studied in neurons expressing control EGFP or DN mutant Rab11. Arc is not included in the commercial PCR array and was used as a positive control of BDNF response. Statistical significance of gene expression data was analyzed by using a paired Student's t test. The level of significance for the different tests is indicated as follows: *p < 0.05; **p < 0.01. A summary of the statistics for this figure, including tests, degrees of freedom, and exact p values, has been included in Extended Data Figure 6-1 supporting Figure 6. See Extended Data Figure 6-2 for a complete list of reliable genes. Extended Data Figure 6-3 includes the raw data and analysis step by step of the PCR array of the six replicas performed.

Article Snippet: Stimulation and measurement of dendritic arborization induced by BDNF Morphologic changes in dendritic arborization induced by BDNF stimulation (50 ng/ml; Alomone Labs) were measured in cultured hippocampal neurons as we previously described ( Lazo et al., 2013 ).

Techniques: Activity Assay, Expressing, Mutagenesis, Positive Control

Rab5 and Rab11 activity is required for sustained BDNF downstream signaling. Hippocampal neurons expressing control EGFP or DN mutants of Rab5 and Rab11 were stimulated with BDNF for 0, 5, or 120 min, and lysates were probed for total and phosphorylated TrkB (Y515), Akt (S473), and Erk1/2 (T202/Y204). A, B, Representative Western blots (A) and quantification of five to seven independent experiments (B) are shown. The first two columns, “Early activation” and “Sustained activation,” were statistically analyzed by using one-way ANOVA, followed by Bonferroni's multiple-comparison post-test, indicated in brackets. The third column was analyzed by two-way ANOVA, which showed no statistically significant differences. Bonferroni's multiple-comparison post-test was applied to compare Rab5DN and Rab11DN against EGFP controls. No significant differences were found. *p < 0.05; ****p < 0.0001; ns, nonsignificant. A summary of the statistics for this figure, including tests, degrees of freedom, and exact p values, has been included in Extended Data Figure 1-1 supporting Figure 1.

Journal: The Journal of Neuroscience

Article Title: The Rab5–Rab11 Endosomal Pathway is Required for BDNF-Induced CREB Transcriptional Regulation in Hippocampal Neurons

doi: 10.1523/JNEUROSCI.2063-19.2020

Figure Lengend Snippet: Rab5 and Rab11 activity is required for sustained BDNF downstream signaling. Hippocampal neurons expressing control EGFP or DN mutants of Rab5 and Rab11 were stimulated with BDNF for 0, 5, or 120 min, and lysates were probed for total and phosphorylated TrkB (Y515), Akt (S473), and Erk1/2 (T202/Y204). A, B, Representative Western blots (A) and quantification of five to seven independent experiments (B) are shown. The first two columns, “Early activation” and “Sustained activation,” were statistically analyzed by using one-way ANOVA, followed by Bonferroni's multiple-comparison post-test, indicated in brackets. The third column was analyzed by two-way ANOVA, which showed no statistically significant differences. Bonferroni's multiple-comparison post-test was applied to compare Rab5DN and Rab11DN against EGFP controls. No significant differences were found. *p < 0.05; ****p < 0.0001; ns, nonsignificant. A summary of the statistics for this figure, including tests, degrees of freedom, and exact p values, has been included in Extended Data Figure 1-1 supporting Figure 1.

Article Snippet: Stimulation and measurement of dendritic arborization induced by BDNF Morphologic changes in dendritic arborization induced by BDNF stimulation (50 ng/ml; Alomone Labs) were measured in cultured hippocampal neurons as we previously described ( Lazo et al., 2013 ).

Techniques: Activity Assay, Expressing, Western Blot, Activation Assay

Reduction of Rab5 activity does not decrease internalization of TrkB or transferrin receptor. A, The level of endocytosis of TrkB-Flag on stimulation with BDNF in neurons expressing Rab5DN mutant or EGFP as a control. Internalized TrkB is expressed as the fold change after BDNF and the fluorescence associated with the soma of 17–25 neurons/condition from three independent experiments. BDNF treatment accounted for the majority of the variation, and no effect of the mutant was found (p = 0.6788). Data were analyzed by using two-way ANOVA and Bonferroni's multiple-comparison post-test revealed a significant effect of BDNF on endocytosis in both EGFP- and Rab5DN-expressing neurons (***<0,001). B, Quantification of fluorescently labeled transferrin internalization is also shown as a control. The fluorescence associated with the soma of 16 neurons per condition from three independent experiments was considered for quantification. No significant differences were found between EGFP- and Rab5DN-expressing neurons (p = 0.1499). Scale bar, 20 µm. C, The effects of expressing EGFP and Rab5DN on the endogenous levels of Rab11 were studied by immunofluorescence using a polyclonal antibody against Rab11. Hippocampal neurons were transduced at 7 DIV and analyzed after 48 h. Left, EGFP/Rab5DN expression is shown in green, and Rab11 expression is shown in red. Right, Levels of Rab11 were measured in the soma and dendrites of hippocampal neurons (9 DIV). For quantification, 22–26 neurons/condition from three independent experiments were considered. Data were analyzed by using Student's t test, and the level of significance is indicated as ****p < 0.0001. Scale bars, 20 µm. A summary of the statistics for this figure, including tests, degrees of freedom, and exact p values, has been included in Extended Data Figure 2-1 supporting Figure 2.

Journal: The Journal of Neuroscience

Article Title: The Rab5–Rab11 Endosomal Pathway is Required for BDNF-Induced CREB Transcriptional Regulation in Hippocampal Neurons

doi: 10.1523/JNEUROSCI.2063-19.2020

Figure Lengend Snippet: Reduction of Rab5 activity does not decrease internalization of TrkB or transferrin receptor. A, The level of endocytosis of TrkB-Flag on stimulation with BDNF in neurons expressing Rab5DN mutant or EGFP as a control. Internalized TrkB is expressed as the fold change after BDNF and the fluorescence associated with the soma of 17–25 neurons/condition from three independent experiments. BDNF treatment accounted for the majority of the variation, and no effect of the mutant was found (p = 0.6788). Data were analyzed by using two-way ANOVA and Bonferroni's multiple-comparison post-test revealed a significant effect of BDNF on endocytosis in both EGFP- and Rab5DN-expressing neurons (***<0,001). B, Quantification of fluorescently labeled transferrin internalization is also shown as a control. The fluorescence associated with the soma of 16 neurons per condition from three independent experiments was considered for quantification. No significant differences were found between EGFP- and Rab5DN-expressing neurons (p = 0.1499). Scale bar, 20 µm. C, The effects of expressing EGFP and Rab5DN on the endogenous levels of Rab11 were studied by immunofluorescence using a polyclonal antibody against Rab11. Hippocampal neurons were transduced at 7 DIV and analyzed after 48 h. Left, EGFP/Rab5DN expression is shown in green, and Rab11 expression is shown in red. Right, Levels of Rab11 were measured in the soma and dendrites of hippocampal neurons (9 DIV). For quantification, 22–26 neurons/condition from three independent experiments were considered. Data were analyzed by using Student's t test, and the level of significance is indicated as ****p < 0.0001. Scale bars, 20 µm. A summary of the statistics for this figure, including tests, degrees of freedom, and exact p values, has been included in Extended Data Figure 2-1 supporting Figure 2.

Article Snippet: Stimulation and measurement of dendritic arborization induced by BDNF Morphologic changes in dendritic arborization induced by BDNF stimulation (50 ng/ml; Alomone Labs) were measured in cultured hippocampal neurons as we previously described ( Lazo et al., 2013 ).

Techniques: Activity Assay, Expressing, Mutagenesis, Fluorescence, Labeling, Immunofluorescence

Nuclear CREB phosphorylation requires Rab5 and Rab11 activity. Hippocampal neurons expressing control EGFP or DN mutants of Rab5 and Rab11 were stimulated with BDNF for 15 min, and lysates were probed for total and phosphorylated CREB. A, B, Representative Western blots (A) and quantification of four independent experiments (B) are shown. Data were analyzed by using two-way ANOVA. Bonferroni's multiple-comparison post-test revealed a significant effect of BDNF on endocytosis in EGFP (**p < 0.01). There were no significant differences (ns) found in Rab5DN- or Rab11DN-expressing neurons treated with BDNF compared with untreated neurons. C–F, To specifically study the amount of phosphorylated CREB in the nucleus, we performed stimulation with BDNF for 0, 15, 30, or 60 min, and we detected phosphorylated CREB by immunofluorescence. Quantification of normalized intensity from 42 to 112 nuclei/condition from four independent experiments is shown (E, F). Datasets were tested by using two-way ANOVA, followed by Bonferroni's multiple-comparison test. Statistically significant differences in pCREB at different time points compared with time = 0 min are indicated within the bar. Differences between EGFP controls and mutant-expressing neurons at specific time points are indicated in brackets. Significance levels are labeled **p < 0.01; ****p < 0.001; and ns, nonsignificant. Scale bars, 10 µm. G, Hippocampal neurons were stimulated with BDNF for 15 min in the presence of the MEK1/2 inhibitor PD98059, the PI3K inhibitor LY294002, or the Trk kinase activity inhibitor K252a, and were then probed for phosphorylated CREB and MAP2 by immunofluorescence. H, Quantification of 30 nuclei/condition from three independent experiments showed a complete block of BDNF-induced CREB phosphorylation in the presence of PD89059. Significant differences compared with nonstimulated neurons were analyzed by using one-way ANOVA, followed by Bonferroni's multiple-comparison post-test and are indicated within the bars ****p < 0.0001. The dependence on TrkB was confirmed by the robust inhibition of BDNF-induced CREB phosphorylation by K252a. In contrast, LY294002 did not have any effect on pCREB, despite its significant inhibition of Akt phosphorylation (pS473), as shown in G and H. I, The null effect of LY294002 on TrkB phosphorylation (pY515) is also shown. A summary of the statistics for this figure, including tests, degrees of freedom, and exact p values, has been included in Extended Data Figure 3-1 supporting Figure 3.

Journal: The Journal of Neuroscience

Article Title: The Rab5–Rab11 Endosomal Pathway is Required for BDNF-Induced CREB Transcriptional Regulation in Hippocampal Neurons

doi: 10.1523/JNEUROSCI.2063-19.2020

Figure Lengend Snippet: Nuclear CREB phosphorylation requires Rab5 and Rab11 activity. Hippocampal neurons expressing control EGFP or DN mutants of Rab5 and Rab11 were stimulated with BDNF for 15 min, and lysates were probed for total and phosphorylated CREB. A, B, Representative Western blots (A) and quantification of four independent experiments (B) are shown. Data were analyzed by using two-way ANOVA. Bonferroni's multiple-comparison post-test revealed a significant effect of BDNF on endocytosis in EGFP (**p < 0.01). There were no significant differences (ns) found in Rab5DN- or Rab11DN-expressing neurons treated with BDNF compared with untreated neurons. C–F, To specifically study the amount of phosphorylated CREB in the nucleus, we performed stimulation with BDNF for 0, 15, 30, or 60 min, and we detected phosphorylated CREB by immunofluorescence. Quantification of normalized intensity from 42 to 112 nuclei/condition from four independent experiments is shown (E, F). Datasets were tested by using two-way ANOVA, followed by Bonferroni's multiple-comparison test. Statistically significant differences in pCREB at different time points compared with time = 0 min are indicated within the bar. Differences between EGFP controls and mutant-expressing neurons at specific time points are indicated in brackets. Significance levels are labeled **p < 0.01; ****p < 0.001; and ns, nonsignificant. Scale bars, 10 µm. G, Hippocampal neurons were stimulated with BDNF for 15 min in the presence of the MEK1/2 inhibitor PD98059, the PI3K inhibitor LY294002, or the Trk kinase activity inhibitor K252a, and were then probed for phosphorylated CREB and MAP2 by immunofluorescence. H, Quantification of 30 nuclei/condition from three independent experiments showed a complete block of BDNF-induced CREB phosphorylation in the presence of PD89059. Significant differences compared with nonstimulated neurons were analyzed by using one-way ANOVA, followed by Bonferroni's multiple-comparison post-test and are indicated within the bars ****p < 0.0001. The dependence on TrkB was confirmed by the robust inhibition of BDNF-induced CREB phosphorylation by K252a. In contrast, LY294002 did not have any effect on pCREB, despite its significant inhibition of Akt phosphorylation (pS473), as shown in G and H. I, The null effect of LY294002 on TrkB phosphorylation (pY515) is also shown. A summary of the statistics for this figure, including tests, degrees of freedom, and exact p values, has been included in Extended Data Figure 3-1 supporting Figure 3.

Article Snippet: Stimulation and measurement of dendritic arborization induced by BDNF Morphologic changes in dendritic arborization induced by BDNF stimulation (50 ng/ml; Alomone Labs) were measured in cultured hippocampal neurons as we previously described ( Lazo et al., 2013 ).

Techniques: Activity Assay, Expressing, Western Blot, Immunofluorescence, Mutagenesis, Labeling, Blocking Assay, Inhibition

Rab5 and Rab11 activity is required for sustained BDNF–Erk1/2 signaling. A, Hippocampal neurons expressing control EGFP or DN mutants of Rab5 and Rab11 were stimulated with BDNF for 0–60 min, and sustained activation of Erk1/2 was analyzed in different neuronal compartments (nuclei, somas, dendrites) by immunofluorescence. Nuclei were traced using Hoechst staining as a reference and are indicated here with a dashed line. Examples of positive dendrites in EGFP and Rab11DN neurons are indicated by white arrowheads. Scale bar, 10 µm. B, Quantification of normalized intensity from 30 nuclei and somas and 60 dendrites from three independent experiments is shown. In B, differences between time = 0 and 60 min of BDNF stimulation are indicated at the bottom of the bar. The effect of the expression of the Rab5 and Rab11 mutants compared with EGFP after 60 min of BDNF stimulation is indicated in brackets. Statistical differences were tested by using two-way ANOVA, followed by Bonferroni's multiple-comparison test. **p < 0.01; ****p < 0.0001. C, The ability of PD98059 to inhibit BDNF-induced phosphorylation of Erk1/2 was confirmed by stimulating hippocampal neurons with BDNF for 15 min and performing double immunofluorescence for MAP2 and pErk1/2. D, Quantification of this effect in somas, dendrites, and nuclei is shown. Quantification of the normalized intensity of the soma and nucleus from 30–45 neurons/condition from three independent experiments is shown. Statistical differences were analyzed by using the Kruskal–Wallis nonparametric test, and Bonferroni's multiple-comparison post-test was applied to analyze differences between groups. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001. A summary of the statistics for this figure, including tests, degrees of freedom, and exact p values, has been included in Extended Data Figure 4-1 supporting Figure 4.

Journal: The Journal of Neuroscience

Article Title: The Rab5–Rab11 Endosomal Pathway is Required for BDNF-Induced CREB Transcriptional Regulation in Hippocampal Neurons

doi: 10.1523/JNEUROSCI.2063-19.2020

Figure Lengend Snippet: Rab5 and Rab11 activity is required for sustained BDNF–Erk1/2 signaling. A, Hippocampal neurons expressing control EGFP or DN mutants of Rab5 and Rab11 were stimulated with BDNF for 0–60 min, and sustained activation of Erk1/2 was analyzed in different neuronal compartments (nuclei, somas, dendrites) by immunofluorescence. Nuclei were traced using Hoechst staining as a reference and are indicated here with a dashed line. Examples of positive dendrites in EGFP and Rab11DN neurons are indicated by white arrowheads. Scale bar, 10 µm. B, Quantification of normalized intensity from 30 nuclei and somas and 60 dendrites from three independent experiments is shown. In B, differences between time = 0 and 60 min of BDNF stimulation are indicated at the bottom of the bar. The effect of the expression of the Rab5 and Rab11 mutants compared with EGFP after 60 min of BDNF stimulation is indicated in brackets. Statistical differences were tested by using two-way ANOVA, followed by Bonferroni's multiple-comparison test. **p < 0.01; ****p < 0.0001. C, The ability of PD98059 to inhibit BDNF-induced phosphorylation of Erk1/2 was confirmed by stimulating hippocampal neurons with BDNF for 15 min and performing double immunofluorescence for MAP2 and pErk1/2. D, Quantification of this effect in somas, dendrites, and nuclei is shown. Quantification of the normalized intensity of the soma and nucleus from 30–45 neurons/condition from three independent experiments is shown. Statistical differences were analyzed by using the Kruskal–Wallis nonparametric test, and Bonferroni's multiple-comparison post-test was applied to analyze differences between groups. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001. A summary of the statistics for this figure, including tests, degrees of freedom, and exact p values, has been included in Extended Data Figure 4-1 supporting Figure 4.

Article Snippet: Stimulation and measurement of dendritic arborization induced by BDNF Morphologic changes in dendritic arborization induced by BDNF stimulation (50 ng/ml; Alomone Labs) were measured in cultured hippocampal neurons as we previously described ( Lazo et al., 2013 ).

Techniques: Activity Assay, Expressing, Activation Assay, Immunofluorescence, Staining

CREB is required for BDNF-induced dendritic branching. To confirm whether BDNF-mediated phosphorylation of CREB at S133 was critical for a cellular response, we compared BDNF-induced dendritic branching in neurons expressing either EGFP or a nonphosphorylatable mutant of CREB (S133A). Neurons were transfected after 7 d in vitro and treated with BDNF immediately after transfection for 48 h. A, Then, immunostaining for MAP2 was used to analyze the morphology of the dendritic arbor. B, C, Sholl analysis (B) and direct counting of the number of branching points (C) from 18 neurons/condition in three independent experiments showed that the phosphorylation of CREB is required for BDNF-induced dendritic branching. Sholl curves were compared using two-way ANOVA and Bonferroni's multiple-comparison post-test. Branching points data were analyzed using two-way ANOVA. Significance levels for the different statistical tests are labeled *p < 0.05; **p < 0.01; ****p < 0.0001; ns, nonsignificant. Scale bars, 10 µm. A summary of the statistics for this figure, including tests, degrees of freedom, and exact p values, has been included in Extended Data Figure 5-1 supporting Figure 5.

Journal: The Journal of Neuroscience

Article Title: The Rab5–Rab11 Endosomal Pathway is Required for BDNF-Induced CREB Transcriptional Regulation in Hippocampal Neurons

doi: 10.1523/JNEUROSCI.2063-19.2020

Figure Lengend Snippet: CREB is required for BDNF-induced dendritic branching. To confirm whether BDNF-mediated phosphorylation of CREB at S133 was critical for a cellular response, we compared BDNF-induced dendritic branching in neurons expressing either EGFP or a nonphosphorylatable mutant of CREB (S133A). Neurons were transfected after 7 d in vitro and treated with BDNF immediately after transfection for 48 h. A, Then, immunostaining for MAP2 was used to analyze the morphology of the dendritic arbor. B, C, Sholl analysis (B) and direct counting of the number of branching points (C) from 18 neurons/condition in three independent experiments showed that the phosphorylation of CREB is required for BDNF-induced dendritic branching. Sholl curves were compared using two-way ANOVA and Bonferroni's multiple-comparison post-test. Branching points data were analyzed using two-way ANOVA. Significance levels for the different statistical tests are labeled *p < 0.05; **p < 0.01; ****p < 0.0001; ns, nonsignificant. Scale bars, 10 µm. A summary of the statistics for this figure, including tests, degrees of freedom, and exact p values, has been included in Extended Data Figure 5-1 supporting Figure 5.

Article Snippet: Stimulation and measurement of dendritic arborization induced by BDNF Morphologic changes in dendritic arborization induced by BDNF stimulation (50 ng/ml; Alomone Labs) were measured in cultured hippocampal neurons as we previously described ( Lazo et al., 2013 ).

Techniques: Expressing, Mutagenesis, Transfection, In Vitro, Immunostaining, Labeling

Model summarizing the functional relationship between Rab5-Rab11 GTPases and BDNF/TrkB-mediated CREB transcriptional regulation. In the plasma membrane, BDNF binds TrkB, promoting its activation and internalization in Rab5-positive early endosomes (in green) in dendrites (Moya-Alvarado et al., 2018) and somas of hippocampal neurons. From early endosomes, receptors are sorted to Rab11-positive recycling endosomes (in blue) or to late endosomes/lysosomes for degradation (data not shown). TrkB increases the activity of both Rab5 and Rab11 GTPases (Lazo et al., 2013; Moya-Alvarado et al., 2018), in addition to classical signaling pathways such as PI3K–Akt–mTor (in light yellow) and MAPK/Erk1/2 (in orange). The activity of Rab5 and Rab11 was required for the long-lasting activation of Akt and Erk1/2. Interestingly, reducing the activity of Rab5 diminished the levels of the endogenous Rab11 protein. Consistent with these results, the inhibition of Rab5 activity resulted in severe downregulation of Erk1/2 activation, positioning Rab5 activity upstream of Rab11 and long-lasting Erk1/2 activity. Erk1/2 was required for CREB phosphorylation in the nucleus (in pink), and reducing the activity of both Rab5 and Rab11 blocked CREB phosphorylation. Finally, blocking Rab11 activity reduced early-gene transcriptional regulation mediated by BDNF. Akt activation by BDNF may contribute to Rab5-Rab11-mediated CREB nuclear phosphorylation by increasing the protein levels of both Rab5 and Rab11 GTPases (Moya-Alvarado et al., 2018) and thus support a positive feedback loop for intracellular BDNF/TrkB signaling. Overall, our data support a role for somatic Rab11 recycling endosomes as an integrator of intracellular signaling mediated by BDNF/TrkB signaling endosomes and leading to transcriptional changes. Created with https://biorender.com.

Journal: The Journal of Neuroscience

Article Title: The Rab5–Rab11 Endosomal Pathway is Required for BDNF-Induced CREB Transcriptional Regulation in Hippocampal Neurons

doi: 10.1523/JNEUROSCI.2063-19.2020

Figure Lengend Snippet: Model summarizing the functional relationship between Rab5-Rab11 GTPases and BDNF/TrkB-mediated CREB transcriptional regulation. In the plasma membrane, BDNF binds TrkB, promoting its activation and internalization in Rab5-positive early endosomes (in green) in dendrites (Moya-Alvarado et al., 2018) and somas of hippocampal neurons. From early endosomes, receptors are sorted to Rab11-positive recycling endosomes (in blue) or to late endosomes/lysosomes for degradation (data not shown). TrkB increases the activity of both Rab5 and Rab11 GTPases (Lazo et al., 2013; Moya-Alvarado et al., 2018), in addition to classical signaling pathways such as PI3K–Akt–mTor (in light yellow) and MAPK/Erk1/2 (in orange). The activity of Rab5 and Rab11 was required for the long-lasting activation of Akt and Erk1/2. Interestingly, reducing the activity of Rab5 diminished the levels of the endogenous Rab11 protein. Consistent with these results, the inhibition of Rab5 activity resulted in severe downregulation of Erk1/2 activation, positioning Rab5 activity upstream of Rab11 and long-lasting Erk1/2 activity. Erk1/2 was required for CREB phosphorylation in the nucleus (in pink), and reducing the activity of both Rab5 and Rab11 blocked CREB phosphorylation. Finally, blocking Rab11 activity reduced early-gene transcriptional regulation mediated by BDNF. Akt activation by BDNF may contribute to Rab5-Rab11-mediated CREB nuclear phosphorylation by increasing the protein levels of both Rab5 and Rab11 GTPases (Moya-Alvarado et al., 2018) and thus support a positive feedback loop for intracellular BDNF/TrkB signaling. Overall, our data support a role for somatic Rab11 recycling endosomes as an integrator of intracellular signaling mediated by BDNF/TrkB signaling endosomes and leading to transcriptional changes. Created with https://biorender.com.

Article Snippet: Stimulation and measurement of dendritic arborization induced by BDNF Morphologic changes in dendritic arborization induced by BDNF stimulation (50 ng/ml; Alomone Labs) were measured in cultured hippocampal neurons as we previously described ( Lazo et al., 2013 ).

Techniques: Functional Assay, Activation Assay, Activity Assay, Inhibition, Blocking Assay

Fig. 3. Detection of HPSE activity. Heparanase activity in protein extracts (A) and serum- free conditioned medium (B) obtained from HPSE-silenced-HK2, HK2 wt and HEK293 cell lines. Cells were treated with 60 μg/ml of BSA or AGE (hatched bars) in serum free medium (black bars). Enzymatic activity is expressed as nanograms of heparan sulfate (HS) removed per minute. The results represent the mean±standard deviation of two separate experiments performed in triplicate. Platelet extract was used as a positive control (white bar) (*pb0.05, **pb0.001 vs. HK2 wt control; #pb0.05, ##pb0.001 vs. HEK293 control).

Journal: Biochimica et biophysica acta

Article Title: Regulation of heparanase by albumin and advanced glycation end products in proximal tubular cells.

doi: 10.1016/j.bbamcr.2011.05.004

Figure Lengend Snippet: Fig. 3. Detection of HPSE activity. Heparanase activity in protein extracts (A) and serum- free conditioned medium (B) obtained from HPSE-silenced-HK2, HK2 wt and HEK293 cell lines. Cells were treated with 60 μg/ml of BSA or AGE (hatched bars) in serum free medium (black bars). Enzymatic activity is expressed as nanograms of heparan sulfate (HS) removed per minute. The results represent the mean±standard deviation of two separate experiments performed in triplicate. Platelet extract was used as a positive control (white bar) (*pb0.05, **pb0.001 vs. HK2 wt control; #pb0.05, ##pb0.001 vs. HEK293 control).

Article Snippet: HPSE activity in total cell lysates and cell culture supernatants was quantified using the “Heparanase assay” Kit from AMS Biotechnology (Milton Abingdon, Oxon, UK) according to the manufacturer's instructions.

Techniques: Activity Assay, Standard Deviation, Positive Control, Control